Inconsistency in cutadapt "r1adapter" between README and QuantSeqPoolAnalysis.sh

[freekvh]

In the README, under "Trimming with cutadapt" the following code is presented:

$ cutadapt --quiet -m 20 -O 20 -a "polyA=A{20}" -a "QUALITY=G{20}" -n 2 path/to/output/extracted/sample/R1.fastq.gz | \
> cutadapt --quiet -m 20 -O 3 --nextseq-trim=10 -a "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000" - | \
> cutadapt --quiet -m 20 -O 3 -a "r1polyA=A{18}" - | \
> cutadapt --quiet -m 20 -O 20 -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" --discard-trimmed -o path/to/output/trimmed/sample/R1.fastq.gz -

However, in the QuantSeqPoolAnalysis.sh this code is used:

cutadapt -m 20 -O 20 -a "polyA=A{20}" -a "QUALITY=G{20}" -n 2 ${fastq_extracted}/${sample}/R1.fastq.gz | cutadapt  -m 20 -O 3 --nextseq-trim=10  -a "r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000" - | cutadapt -m 20 -O 3 -a "r1polyA=A{18}" - | cutadapt -m 20 -O 20 -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" --discard-trimmed -o ${fastq_trimmed}/${sample}/R1.fastq.gz - 

There is a difference in the r1adapter= parameter, in the README it says:
"r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000"
In the shell script:
"r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000"

Notice the extra A{18} in the shell script,, which, I guess means 18 A's and should not be there? So the README is actually correct?

[MichaelMoldaschl]

Hi,
thank you for finding this inconsistency. The script is correct and the README is wrong. Because of the polyA priming of QuantSeq, this polyA sequence should be included in the adapter definition.
We will change that in the README soon.

Best,
Michael