README.DEV

= README.DEV

Copyright::  Copyright (C) 2005, 2006 Toshiaki Katayama <k@bioruby.org>
Copyright::  Copyright (C) 2006       Jan Aerts <jan.aerts@bbsrc.ac.uk>

  $Id: README.DEV,v 1.14 2007/04/05 23:35:39 trevor Exp $

= HOW TO CONTRIBUTE TO THE BIORUBY PROJECT?

There are many possible ways to contribute to the BioRuby project,
such as:

* Join the discussion on the BioRuby mailing list
* Send a bug report or write a bug fix patch
* Add and correct documentation
* Develop code for new features, etc.

All of these are welcome!  However, this document describes the last option,
how to contribute your code to the BioRuby distribution.

We would like to include your contribution as long as the scope of
your module meets the field of bioinformatics.

= LICENSE

If you would like your module to be included in the BioRuby distribution,
you need to give us right to change the license of your module to make it
compatible with other modules in BioRuby.

BioRuby was previously distributed under the LGPL license, but now is
distributed under the same terms as Ruby.

= CODING STYLE

You will need to follow the typical coding styles of the BioRuby modules:

== Use the following naming conventions

* CamelCase for module and class names
* '_'-separated_lowercase for method names
* '_'-separated_lowercase for variable names
* all UPPERCASE for constants

== Indentation must not include tabs

* Use 2 spaces for indentation.
* Don't replace spaces to tabs.

== Comments

Don't use <tt>=begin</tt> and <tt>=end</tt> blocks for comments.  If you need to add
comments, include it in the RDoc documentation.

== Documentation should be written in the RDoc format in the source code

The RDoc format is becoming the popular standard for Ruby documentation.
We are now in transition from the previously used RD format to the RDoc
format in API documentation.

Additional tutorial documentation and working examples are encouraged
with your contribution.  You may use the header part of the file for
this purpose as demonstrated in the previous section.

== Standard documentation

=== of files

Each file should start with a header, which covers the following topics:
* copyright
* license
* description of the file (_not_ the classes; see below)
* any references, if appropriate

The header should be formatted as follows:

  #
  # = bio/db/hoge.rb - Hoge database parser classes
  #
  # Copyright::  Copyright (C) 2001, 2003-2005 Bio R. Hacker <brh@example.org>,
  # Copyright::  Copyright (C) 2006 Chem R. Hacker <crh@example.org>
  #
  # License::    The Ruby License
  #
  # $ I d: $
  #
  # == Description
  #
  # This file contains classes that implement an interface to the Hoge database.
  #
  # == References
  #
  # * Hoge F. et al., The Hoge database, Nucleic. Acid. Res. 123:100--123 (2030)
  # * http://hoge.db/
  #

  require 'foo'

  module Bio

    autoload :Bar, 'bio/bar'

  class Hoge
    :
  end  # Hoge

  end  # Bio

In the above sample, the '$ I d : $' (without spaces) will be automatically
changed into something like

  $Id: README.DEV,v 1.14 2007/04/05 23:35:39 trevor Exp $

when commiting to the CVS repository for the first time.

=== of classes and methods within those files

Classes and methods should be documented in a standardized format, as in the
following example (from lib/bio/sequence.rb):

  # == Description
  #
  # Bio::Sequence objects represent annotated sequences in bioruby.
  # A Bio::Sequence object is a wrapper around the actual sequence, 
  # represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object.
  # For most users, this encapsulation will be completely transparent.
  # Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA
  # objects using the same arguments and returning the same values (even though 
  # these methods are not documented specifically for Bio::Sequence).
  #
  # == Usage
  # 
  #   require 'bio'
  #   
  #   # Create a nucleic or amino acid sequence
  #   dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
  #   rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
  #   aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU')
  # 
  #   # Print in FASTA format
  #   puts dna.output(:fasta)
  # 
  #   # Print all codons
  #   dna.window_search(3,3) do |codon|
  #     puts codon
  #   end
  # 
  class Sequence
  
    # Create a new Bio::Sequence object
    #
    #   s = Bio::Sequence.new('atgc')
    #   puts s                                  # => 'atgc'
    #
    # Note that this method does not intialize the contained sequence
    # as any kind of bioruby object, only as a simple string
    #
    #   puts s.seq.class                        # => String
    #
    # See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto 
    # for methods to transform the basic String of a just created 
    # Bio::Sequence object to a proper bioruby object
    # ---
    # *Arguments*:
    # * (required) _str_: String or Bio::Sequence::NA/AA object
    # *Returns*:: Bio::Sequence object
    def initialize(str)
      @seq = str
    end
  
    # The sequence identifier.  For example, for a sequence
    # of Genbank origin, this is the accession number.
    attr_accessor :entry_id
  
    # An Array of Bio::Feature objects
    attr_accessor :features
  end # Sequence

Preceding the class definition (<tt>class Sequence</tt>), there is at least a 
description and a usage example. Please use the +Description+ and +Usage+
headings. If appropriate, refer to other classes that interact with or are
related to the class.

The code in the usage example should, if possible, be in a format that a user
can copy-and-paste into a new script to run. It should illustrate the most
important uses of the class. If possible and if it would not clutter up the
example too much, try to provide any input data directly into the usage example,
instead of refering to ARGV or ARGF for input.

  dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')

Otherwise, describe the input shortly, for example:

  # input should be string consisting of nucleotides
  dna = Bio::Sequence.auto(ARGF.read)

Methods should be preceded by a comment that describes what the method does, 
including any relevant usage examples. (In contrast to the documentation for
the class itself, headings are not required.) In addition, any arguments should
be listed, as well as the type of thing that is returned by the method. The
format of this information is as follows:

  # ---
  # *Arguments*:
  # * (required) _str_: String or Bio::Sequence::NA
  # * (optional) _nr_: a number that means something
  # *Returns*:: true or false

Attribute accessors can be preceded by a short description.

== Exception handling

Don't use

  $stderr.puts "WARNING"

in your code. Instead, try to avoid printing error messages. For fatal errors,
use +raise+ with an appropriate message.

== Testing code should use 'test/unit'

Unit tests should come with your modules by which you can assure what
you meant to do with each method.  The test code is useful to make
maintenance easy and ensure stability. The use of

  if __FILE__ == $0

is deprecated.

== Using autoload

To quicken the initial load time we have replaced most of 'require' to 
'autoload' since BioRuby version 0.7.  During this change, we have found
some tips:

You should not separate the same namespace into several files.

* For example, if you have separated definitions of the Bio::Foo
  class into two files (e.g. 'bio/foo.rb' and 'bio/bar.rb'), you
  need to resolve the dependencies (including the load order)
  yourself.

* If you have a defined Bio::Foo in 'bio/foo.rb' and a defined
  Bio::Foo::Bar in 'bio/foo/bar.rb' add the following line in the
  'bio/foo.rb' file:

    autoload :Bar, 'bio/foo/bar'
    
You should not put several top level namespaces in one file.

* For example, if you have Bio::A, Bio::B and Bio::C in the file
  'bio/foo.rb', you need

    autoload :A, 'bio/foo'
    autoload :B, 'bio/foo'
    autoload :C, 'bio/foo'

  to load the module automatically (instead of require 'bio/foo').
  In this case, you should put them under the new namespace like
  Bio::Foo::A, Bio::Foo::B and Bio::Foo::C in the file 'bio/foo',
  then use

    autoload :Foo, 'bio/foo'

  so autoload can be written in 1 line.

= NAMESPACE

Your module should be located under the top-level module Bio and put under
the 'bioruby/lib/bio' directory.  The class/module names and the
file names should be short and descriptive.

There are already several sub directories in 'bioruby/lib':

  bio/*.rb   -- general and widely used basic classes
  bio/appl/  -- wrapper and parser for the external applications
  bio/data/  -- basic biological data
  bio/db/    -- flatfile database entry parsers
  bio/io/    -- I/O interfaces for files, RDB, web services etc.
  bio/util/  -- utilities and algorithms for bioinformatics

If your module doesn't match any of the above, please propose
an appropriate directory name when you contribute. Please let the staff
discuss on namespaces (class names), API (method names) before commiting
a new module or making changes on existing modules.

= MAINTENANCE

Finally, please maintain the code you've contributed.  The BioRuby
staff is willing to give you CVS privileges if needed.
Please let us know (on the bioruby list) before you commit, so that users
can discuss on the change.