From f81442a1eecdd9b7b1e2b0fb667d5b65a3d73d40 Mon Sep 17 00:00:00 2001
From: diana chJ <122611454+dianichj@users.noreply.github.com>
Date: Tue, 24 Sep 2024 14:21:24 +0200
Subject: [PATCH 01/11] Update seqtk_mergefa.xml

- Restricted input formats to only FASTA and compressed FASTA files (.fasta, .fasta.gz). Removed support for FASTQ files.
- Updated the tool description and help section to accurately reflect that the tool only merges FASTA files.
- Improved the tool's clarity by ensuring it is used for its intended purpose: merging FASTA files only.
---
 tools/seqtk/seqtk_mergefa.xml | 12 ++++++------
 1 file changed, 6 insertions(+), 6 deletions(-)

diff --git a/tools/seqtk/seqtk_mergefa.xml b/tools/seqtk/seqtk_mergefa.xml
index 5198df76924..ce62fb4ac98 100644
--- a/tools/seqtk/seqtk_mergefa.xml
+++ b/tools/seqtk/seqtk_mergefa.xml
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
-    <description>merge two FASTA/Q files</description>
+    <description>Merge two FASTA files</description>
     <macros>
         <import>macros.xml</import>
     </macros>
@@ -16,14 +16,14 @@ $r
 $h
 '$in_fa1'
 '$in_fa2'
-#echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
+#echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz') else "" # > '$default'
     ]]></command>
     <inputs>
-        <param name="in_fa1" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #1"/>
-        <param name="in_fa2" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #2"/>
+        <param name="in_fa1" type="data" format="fasta,fasta.gz" label="Input FASTA file #1"/>
+        <param name="in_fa2" type="data" format="fasta,fasta.gz" label="Input FASTA file #2"/>
         <param argument="-q" type="integer" value="0" label="Quality threshold"/>
         <param argument="-i" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Take intersection" />
-        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase when one of the input base is N" />
+        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase when one of the input bases is N" />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Pick a random allele from het" />
         <param argument="-h" type="boolean" truevalue="-h" falsevalue="" checked="false" label="Suppress hets in the input" />
     </inputs>
@@ -52,7 +52,7 @@ $h
     <help><![CDATA[
 **What it does**
 
-Merges two fasta files, using ambiguity codes
+Merges two FASTA files using ambiguity codes.
 
 ::
 

From bdd1286b299578ddb1ba76eb1e0a4e865158cf22 Mon Sep 17 00:00:00 2001
From: diana chJ <122611454+dianichj@users.noreply.github.com>
Date: Thu, 26 Sep 2024 15:08:32 +0200
Subject: [PATCH 02/11] Update seqtk_mergefa.xml

"Tool merges FASTA/Q files into a FASTA output and considers the quality threshold for FASTQ files when merging."

1. Clarified the -m option to handle ambiguous bases and conflicts (e.g., N and other IUPAC codes).
2. Improved help documentation with clearer examples and explanations.
3. Refined input parameter labels for better clarity and consistency.
---
 tools/seqtk/seqtk_mergefa.xml | 27 ++++++++++++++++-----------
 1 file changed, 16 insertions(+), 11 deletions(-)

diff --git a/tools/seqtk/seqtk_mergefa.xml b/tools/seqtk/seqtk_mergefa.xml
index ce62fb4ac98..4b60dc5407c 100644
--- a/tools/seqtk/seqtk_mergefa.xml
+++ b/tools/seqtk/seqtk_mergefa.xml
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
-    <description>Merge two FASTA files</description>
+    <description>Merge two FASTA/Q files into a FASTA file output</description>
     <macros>
         <import>macros.xml</import>
     </macros>
@@ -16,14 +16,14 @@ $r
 $h
 '$in_fa1'
 '$in_fa2'
-#echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz') else "" # > '$default'
+echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
     ]]></command>
     <inputs>
-        <param name="in_fa1" type="data" format="fasta,fasta.gz" label="Input FASTA file #1"/>
-        <param name="in_fa2" type="data" format="fasta,fasta.gz" label="Input FASTA file #2"/>
-        <param argument="-q" type="integer" value="0" label="Quality threshold"/>
+        <param name="in_fa1" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #1"/>
+        <param name="in_fa2" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #2"/>
+        <param argument="-q" type="integer" value="0" label="Quality threshold (for FASTQ)"/>
         <param argument="-i" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Take intersection" />
-        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase when one of the input bases is N" />
+        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase for ambiguous bases or conflicts (e.g., N)" />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Pick a random allele from het" />
         <param argument="-h" type="boolean" truevalue="-h" falsevalue="" checked="false" label="Suppress hets in the input" />
     </inputs>
@@ -52,9 +52,11 @@ $h
     <help><![CDATA[
 **What it does**
 
-Merges two FASTA files using ambiguity codes.
+This tool merges two FASTA or FASTQ files into a single FASTA file using IUPAC ambiguity codes where appropriate. 
+When differences occur between the sequences, ambiguity codes are used to represent possible variations. 
+Additionally, if the `-m` option is set, the tool highlights conflicts by converting nucleotides to lowercase when one of the sequences contains an ambiguity code (e.g., `N`).
 
-::
+### Example:
 
     # seq1.fa
     >test0
@@ -64,13 +66,16 @@ Merges two FASTA files using ambiguity codes.
     >test0
     ACTGAMTGCGN
 
-In the following the `-m` option has been set to highlight seqtk-mergefa's features.
-
-::
+With the `-m` option enabled, the tool merges the sequences and handles ambiguities or conflicts as follows:
 
     >test0
     ACTGACTGxxa
 
+Explanation:
+- Positions with exact matches remain unchanged.
+- Positions where no IUPAC code can represent the conflict are marked with placeholders (e.g., `x`).
+- If one sequence contains an ambiguous base (e.g., `N`), the corresponding nucleotide in the other sequence is converted to lowercase to indicate uncertainty.
+
 @ATTRIBUTION@
     ]]></help>
     <expand macro="citation" />

From 24ef697d86ef795e19adba7f56058ab512487d61 Mon Sep 17 00:00:00 2001
From: diana chJ <122611454+dianichj@users.noreply.github.com>
Date: Thu, 26 Sep 2024 15:31:42 +0200
Subject: [PATCH 03/11] Update seqtk_mergefa.xml

edited echo command line back to #echo
---
 tools/seqtk/seqtk_mergefa.xml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/tools/seqtk/seqtk_mergefa.xml b/tools/seqtk/seqtk_mergefa.xml
index 4b60dc5407c..f5f03489a9a 100644
--- a/tools/seqtk/seqtk_mergefa.xml
+++ b/tools/seqtk/seqtk_mergefa.xml
@@ -16,7 +16,7 @@ $r
 $h
 '$in_fa1'
 '$in_fa2'
-echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
+#echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
     ]]></command>
     <inputs>
         <param name="in_fa1" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #1"/>

From a2528005de87f690524683a006a5b42e6749c90b Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Tue, 1 Oct 2024 16:00:18 +0200
Subject: [PATCH 04/11] adjust output format for -A

---
 tools/seqtk/seqtk_seq.xml | 15 ++++++++++++---
 1 file changed, 12 insertions(+), 3 deletions(-)

diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index 9ae0301d749..51bac930ebf 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -23,7 +23,9 @@ seqtk seq -q $q
 -L $L
 $c
 $r
-$A
+#if $force_fasta == "Yes"
+    -A
+#end if
 $C
 $N
 $x1
@@ -47,14 +49,21 @@ $x2
         <param argument="-L" type="integer" value="0" label="Drop sequences with length shorter than INT" />
         <param argument="-c" type="boolean" truevalue="-c" falsevalue="" checked="false" label="Mask complement region" help="Effective with -M" />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Reverse complement" />
-        <param argument="-A" type="boolean" truevalue="-A" falsevalue="" checked="false" label="Force FASTA output (discard quality)" />
+        <param name="force_fasta" type="select" label="Force FASTA output (discard quality)" value="No">
+            <option value="No">No</option>
+            <option value="Yes">Yes</option>
+        </param>
         <param argument="-C" type="boolean" truevalue="-C" falsevalue="" checked="false" label="Drop comments at the header lines" />
         <param argument="-N" type="boolean" truevalue="-N" falsevalue="" checked="false" label="Drop sequences containing ambiguous bases" />
         <param name="x1" argument="-1" type="boolean" truevalue="-1" falsevalue="" checked="false" label="Output the 2n-1 reads only" />
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}" />
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}" >
+            <change_format>
+                <when input="force_fasta" value="Yes" format="fasta" />
+            </change_format>
+        </data>
     </outputs>
     <tests>
         <!-- This is a sorry excuse for a test for a tool which does way more

From b43a5df12d1458b57e2db3d43409eb9237c3c745 Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Tue, 1 Oct 2024 16:27:17 +0200
Subject: [PATCH 05/11] add test

---
 tools/seqtk/seqtk_seq.xml | 7 +++++++
 1 file changed, 7 insertions(+)

diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index 51bac930ebf..35fc287a86f 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -82,6 +82,13 @@ $x2
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta.gz"/>
         </test>
+        <test>
+            <param name="in_file" value="seqtk_seq.fa.gz" ftype="fasta.gz"/>
+            <param name="r" value="True"/>
+            <param name="n" value=""/>
+            <param name="force_fasta" value="Yes" />
+            <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta"/>
+        </test>
     </tests>
     <help><![CDATA[
 **What it does**

From f27e7ac6e41f544125bbd88203eb7c3ccd24c7ea Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Sat, 5 Oct 2024 16:36:50 +0200
Subject: [PATCH 06/11] add compressed output and tests for parameter A

---
 tools/seqtk/seqtk_seq.xml                  |  45 ++++++++++++---------
 tools/seqtk/test-data/seqtk_seq_A.fasta    |   2 +
 tools/seqtk/test-data/seqtk_seq_A.fasta.gz | Bin 0 -> 72 bytes
 3 files changed, 29 insertions(+), 18 deletions(-)
 create mode 100644 tools/seqtk/test-data/seqtk_seq_A.fasta
 create mode 100644 tools/seqtk/test-data/seqtk_seq_A.fasta.gz

diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index 35fc287a86f..c680e89f971 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -1,5 +1,5 @@
 <?xml version="1.0"?>
-<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
+<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@+galaxy1" profile="22.05">
     <description>common transformation of FASTA/Q</description>
     <macros>
         <import>macros.xml</import>
@@ -23,9 +23,7 @@ seqtk seq -q $q
 -L $L
 $c
 $r
-#if $force_fasta == "Yes"
-    -A
-#end if
+$A
 $C
 $N
 $x1
@@ -34,7 +32,16 @@ $x2
     -V
 #end if
 '$in_file'
-@CONDITIONAL_GZIP_OUT@
+
+#if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz'):
+    | pigz --no-name --no-time > '$output_file'
+#elif $A:
+    > '$output_file'
+#elif $in_file.is_of_type('fasta.gz', 'fastq.gz'):
+    | pigz --no-name --no-time > '$default'
+#else:
+    > '$default'
+#end if
     ]]></command>
     <inputs>
         <expand macro="in_faq"/>
@@ -49,22 +56,21 @@ $x2
         <param argument="-L" type="integer" value="0" label="Drop sequences with length shorter than INT" />
         <param argument="-c" type="boolean" truevalue="-c" falsevalue="" checked="false" label="Mask complement region" help="Effective with -M" />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Reverse complement" />
-        <param name="force_fasta" type="select" label="Force FASTA output (discard quality)" value="No">
-            <option value="No">No</option>
-            <option value="Yes">Yes</option>
-        </param>
+        <param argument="-A" type="boolean" truevalue="-A" falsevalue="" checked="false" label="Force FASTA output (discard quality)" />
         <param argument="-C" type="boolean" truevalue="-C" falsevalue="" checked="false" label="Drop comments at the header lines" />
         <param argument="-N" type="boolean" truevalue="-N" falsevalue="" checked="false" label="Drop sequences containing ambiguous bases" />
         <param name="x1" argument="-1" type="boolean" truevalue="-1" falsevalue="" checked="false" label="Output the 2n-1 reads only" />
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}" >
-            <change_format>
-                <when input="force_fasta" value="Yes" format="fasta" />
-            </change_format>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}">
+            <filter>A == False</filter>
+        </data>
+        <data name="output_file" auto_format="true" label="${tool.name} on ${on_string}">
+            <filter>A</filter>
         </data>
     </outputs>
+
     <tests>
         <!-- This is a sorry excuse for a test for a tool which does way more
              than it should, but upstream decided to put a TON of functionality
@@ -83,11 +89,14 @@ $x2
             <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta.gz"/>
         </test>
         <test>
-            <param name="in_file" value="seqtk_seq.fa.gz" ftype="fasta.gz"/>
-            <param name="r" value="True"/>
-            <param name="n" value=""/>
-            <param name="force_fasta" value="Yes" />
-            <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta"/>
+            <param name="in_file" value="seqtk_trimfq.fq" ftype="fastq"/>
+            <param name="A" value="True" />
+            <output name="output_file" file="seqtk_seq_A.fasta" ftype="fasta"/>
+        </test>
+        <test>
+            <param name="in_file" value="seqtk_trimfq.fq.gz" ftype="fastq.gz"/>
+            <param name="A" value="True" />
+            <output name="output_file" file="seqtk_seq_A.fasta.gz" ftype="fasta.gz"/>
         </test>
     </tests>
     <help><![CDATA[
diff --git a/tools/seqtk/test-data/seqtk_seq_A.fasta b/tools/seqtk/test-data/seqtk_seq_A.fasta
new file mode 100644
index 00000000000..12b15320df2
--- /dev/null
+++ b/tools/seqtk/test-data/seqtk_seq_A.fasta
@@ -0,0 +1,2 @@
+>SEQ_ID1
+GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
diff --git a/tools/seqtk/test-data/seqtk_seq_A.fasta.gz b/tools/seqtk/test-data/seqtk_seq_A.fasta.gz
new file mode 100644
index 0000000000000000000000000000000000000000..5457bf41ab0b3f4892791a1682c36d70282f6384
GIT binary patch
literal 72
zcmb2|=3oE==FQw?yglDb44)L0^Kfz&vNuf-NOyO4FHd*>E^u5ReStxTG}9wS&GhsQ
YMjNEk6&Qm=g$}VYT>EIG?*=pg0Qm70djJ3c

literal 0
HcmV?d00001


From c62ebf6601e6cf8164eb920b7095178d98c388ad Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Sat, 5 Oct 2024 17:03:15 +0200
Subject: [PATCH 07/11] fix lint warnings

---
 tools/seqtk/seqtk_seq.xml | 30 ++++++++----------------------
 1 file changed, 8 insertions(+), 22 deletions(-)

diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index c680e89f971..334c9488150 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -32,16 +32,7 @@ $x2
     -V
 #end if
 '$in_file'
-
-#if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz'):
-    | pigz --no-name --no-time > '$output_file'
-#elif $A:
-    > '$output_file'
-#elif $in_file.is_of_type('fasta.gz', 'fastq.gz'):
-    | pigz --no-name --no-time > '$default'
-#else:
-    > '$default'
-#end if
+@CONDITIONAL_GZIP_OUT@
     ]]></command>
     <inputs>
         <expand macro="in_faq"/>
@@ -63,12 +54,7 @@ $x2
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}">
-            <filter>A == False</filter>
-        </data>
-        <data name="output_file" auto_format="true" label="${tool.name} on ${on_string}">
-            <filter>A</filter>
-        </data>
+        <data name="default" auto_format="true" label="${tool.name} on ${on_string}" />
     </outputs>
 
     <tests>
@@ -76,27 +62,27 @@ $x2
              than it should, but upstream decided to put a TON of functionality
              into a single tool rather than using the single responsibility
              principle. -->
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa" ftype="fasta"/>
         </test>
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa.gz" ftype="fasta.gz"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta.gz"/>
         </test>
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_trimfq.fq" ftype="fastq"/>
             <param name="A" value="True" />
-            <output name="output_file" file="seqtk_seq_A.fasta" ftype="fasta"/>
+            <output name="default" file="seqtk_seq_A.fasta" ftype="fasta"/>
         </test>
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_trimfq.fq.gz" ftype="fastq.gz"/>
             <param name="A" value="True" />
-            <output name="output_file" file="seqtk_seq_A.fasta.gz" ftype="fasta.gz"/>
+            <output name="default" file="seqtk_seq_A.fasta.gz" ftype="fasta.gz"/>
         </test>
     </tests>
     <help><![CDATA[

From f3fcdc561f042279d53975233c523f794fbdff09 Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Tue, 8 Oct 2024 12:13:23 +0200
Subject: [PATCH 08/11] determine output format using metadata

---
 tools/seqtk/macros.xml    | 29 +++++++++++++++++++++++++++++
 tools/seqtk/seqtk_seq.xml |  3 ++-
 2 files changed, 31 insertions(+), 1 deletion(-)

diff --git a/tools/seqtk/macros.xml b/tools/seqtk/macros.xml
index 1563912be65..0e60565e79a 100644
--- a/tools/seqtk/macros.xml
+++ b/tools/seqtk/macros.xml
@@ -40,6 +40,35 @@
 This Galaxy tool relies on the seqtk toolkit from  `lh3/seqtk
 <https://github.com/lh3/seqtk/>`_, developed by Heng Li at the Broad Institute
     ]]></token>
+    <token name="@GENERATE_GALAXY_JSON_SEQTK_SEQ@"><![CDATA[
+        #import json
+
+        #try:
+            #silent $outputs[0]
+        #except 
+            #set outputs = [("default", $default)]
+        #end try
+
+        #set ext = None
+
+        #if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
+            #set ext = "fasta.gz"
+        #elif $A
+            #set ext = "fasta"
+        #elif $in_file.is_of_type('fasta.gz')
+            #set ext = "fasta.gz"
+        #elif $in_file.is_of_type('fastq.gz')
+            #set ext = "fastq.gz"
+        #elif $in_file.is_of_type('fasta')
+            #set ext = "fasta"
+        #elif $in_file.is_of_type('fastq')
+            #set ext = "fastq"
+        #end if
+
+        #set gxy_json = {}
+        #silent gxy_json["default"] = {"ext": ext}
+        && echo '${json.dumps(gxy_json)}' >> galaxy.json
+    ]]></token>
     <xml name="citation">
         <citations>
             <citation type="bibtex">
diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index 334c9488150..e773b2a1baa 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -33,6 +33,7 @@ $x2
 #end if
 '$in_file'
 @CONDITIONAL_GZIP_OUT@
+@GENERATE_GALAXY_JSON_SEQTK_SEQ@
     ]]></command>
     <inputs>
         <expand macro="in_faq"/>
@@ -54,7 +55,7 @@ $x2
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
     <outputs>
-        <data name="default" auto_format="true" label="${tool.name} on ${on_string}" />
+        <data name="default" format="auto" label="${tool.name} on ${on_string}" />
     </outputs>
 
     <tests>

From ce62a76d18b495e6b980b291e28297aceb4b6438 Mon Sep 17 00:00:00 2001
From: RZ9082 <randzoabi.rz@gmail.com>
Date: Wed, 9 Oct 2024 11:09:43 +0200
Subject: [PATCH 09/11] galaxy.json configfile

---
 tools/seqtk/macros.xml    | 29 -----------------------------
 tools/seqtk/seqtk_seq.xml | 16 +++++++++++++++-
 2 files changed, 15 insertions(+), 30 deletions(-)

diff --git a/tools/seqtk/macros.xml b/tools/seqtk/macros.xml
index 0e60565e79a..1563912be65 100644
--- a/tools/seqtk/macros.xml
+++ b/tools/seqtk/macros.xml
@@ -40,35 +40,6 @@
 This Galaxy tool relies on the seqtk toolkit from  `lh3/seqtk
 <https://github.com/lh3/seqtk/>`_, developed by Heng Li at the Broad Institute
     ]]></token>
-    <token name="@GENERATE_GALAXY_JSON_SEQTK_SEQ@"><![CDATA[
-        #import json
-
-        #try:
-            #silent $outputs[0]
-        #except 
-            #set outputs = [("default", $default)]
-        #end try
-
-        #set ext = None
-
-        #if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
-            #set ext = "fasta.gz"
-        #elif $A
-            #set ext = "fasta"
-        #elif $in_file.is_of_type('fasta.gz')
-            #set ext = "fasta.gz"
-        #elif $in_file.is_of_type('fastq.gz')
-            #set ext = "fastq.gz"
-        #elif $in_file.is_of_type('fasta')
-            #set ext = "fasta"
-        #elif $in_file.is_of_type('fastq')
-            #set ext = "fastq"
-        #end if
-
-        #set gxy_json = {}
-        #silent gxy_json["default"] = {"ext": ext}
-        && echo '${json.dumps(gxy_json)}' >> galaxy.json
-    ]]></token>
     <xml name="citation">
         <citations>
             <citation type="bibtex">
diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index e773b2a1baa..1225996f035 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -8,6 +8,7 @@
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
+cp $c1 galaxy.json &&
 seqtk seq -q $q
 -X $X
 #if $n:
@@ -33,8 +34,21 @@ $x2
 #end if
 '$in_file'
 @CONDITIONAL_GZIP_OUT@
-@GENERATE_GALAXY_JSON_SEQTK_SEQ@
     ]]></command>
+    <configfiles>
+    <configfile name="c1">
+        #set $ext = None
+        #if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
+            #set $ext = "fasta.gz"
+        #elif $A
+            #set $ext = "fasta"
+        #else
+            #set $ext = $in_file.ext
+        #end if
+        
+        {"default": {"ext": "$ext"}}
+    </configfile>
+</configfiles>
     <inputs>
         <expand macro="in_faq"/>
         <param argument="-q" type="integer" value="0" label="Mask bases with quality lower than INT" />

From 4ebc92580e24aea3f46a601ed5dbd9ab65d3ef5d Mon Sep 17 00:00:00 2001
From: Wolfgang Maier <maierw@informatik.uni-freiburg.de>
Date: Tue, 15 Oct 2024 17:40:48 +0200
Subject: [PATCH 10/11] Ensure correct output formats of seqtk mergefa and fix
 help

---
 tools/seqtk/seqtk_mergefa.xml | 47 +++++++++++++++++++++--------------
 1 file changed, 28 insertions(+), 19 deletions(-)

diff --git a/tools/seqtk/seqtk_mergefa.xml b/tools/seqtk/seqtk_mergefa.xml
index f5f03489a9a..d82f5944801 100644
--- a/tools/seqtk/seqtk_mergefa.xml
+++ b/tools/seqtk/seqtk_mergefa.xml
@@ -1,5 +1,5 @@
 <?xml version="1.0"?>
-<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
+<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@+galaxy1" profile="22.05">
     <description>Merge two FASTA/Q files into a FASTA file output</description>
     <macros>
         <import>macros.xml</import>
@@ -18,17 +18,28 @@ $h
 '$in_fa2'
 #echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
     ]]></command>
+    <configfiles>
+        <configfile filename="outputs.json">
+#set $ext = None
+#if $in_fa1.is_of_type('fasta.gz', 'fastq.gz')
+    #set $ext = "fasta.gz"
+#else
+    #set $ext = "fasta"
+#end if
+{"default": {"ext": "$ext"}}
+        </configfile>
+    </configfiles>
     <inputs>
         <param name="in_fa1" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #1"/>
         <param name="in_fa2" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #2"/>
         <param argument="-q" type="integer" value="0" label="Quality threshold (for FASTQ)"/>
         <param argument="-i" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Take intersection" />
-        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase for ambiguous bases or conflicts (e.g., N)" />
+        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Pick least ambiguous, mask conflicts and uncertainties" help="Tries to pick the least ambiguous symbol from the two inputs, but masks contradictory bases in the inputs as x in the merged result and converts the merged base to lowercase where one of the input bases is an N." />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Pick a random allele from het" />
         <param argument="-h" type="boolean" truevalue="-h" falsevalue="" checked="false" label="Suppress hets in the input" />
     </inputs>
-    <outputs>
-        <data name="default" format_source="in_fa1" label="${tool.name} on ${on_string}"/>
+    <outputs provided_metadata_file="outputs.json">
+        <data name="default" format="auto" label="${tool.name} on ${on_string}" />
     </outputs>
     <tests>
         <test>
@@ -54,27 +65,25 @@ $h
 
 This tool merges two FASTA or FASTQ files into a single FASTA file using IUPAC ambiguity codes where appropriate. 
 When differences occur between the sequences, ambiguity codes are used to represent possible variations. 
-Additionally, if the `-m` option is set, the tool highlights conflicts by converting nucleotides to lowercase when one of the sequences contains an ambiguity code (e.g., `N`).
 
-### Example:
+Example::
 
-    # seq1.fa
-    >test0
-    ACTGACTGAAA
+  >seq1
+  ACTGACTGAAA
 
-    # seq2.fa
-    >test0
-    ACTGAMTGCGN
+  >seq2
+  ACTGAMTGCGN
 
-With the `-m` option enabled, the tool merges the sequences and handles ambiguities or conflicts as follows:
+will result in::
 
-    >test0
-    ACTGACTGxxa
+  >seq1
+  ACTGAMTGMRN
 
-Explanation:
-- Positions with exact matches remain unchanged.
-- Positions where no IUPAC code can represent the conflict are marked with placeholders (e.g., `x`).
-- If one sequence contains an ambiguous base (e.g., `N`), the corresponding nucleotide in the other sequence is converted to lowercase to indicate uncertainty.
+If the `-m` option is in use, however, the tool will pick the least ambiguous base if there is no contradiction between the symbols in the inputs. Conflicts are indicated by using x in the merged sequence and the picked base is converted to lowercase if the less specific symbol is an N to express uncertainty.
+With this logic the input sequences above will result in the merge result::
+
+  >seq1
+  ACTGACTGxxa
 
 @ATTRIBUTION@
     ]]></help>

From ea8b4dd69e64e3deeff69c989ec5d628f1cce8ed Mon Sep 17 00:00:00 2001
From: Wolfgang Maier <maierw@informatik.uni-freiburg.de>
Date: Tue, 15 Oct 2024 17:42:52 +0200
Subject: [PATCH 11/11] More simplifications and some parameter fixes

---
 tools/seqtk/seqtk_seq.xml | 31 ++++++++++++++-----------------
 1 file changed, 14 insertions(+), 17 deletions(-)

diff --git a/tools/seqtk/seqtk_seq.xml b/tools/seqtk/seqtk_seq.xml
index 1225996f035..9c28ed7f143 100644
--- a/tools/seqtk/seqtk_seq.xml
+++ b/tools/seqtk/seqtk_seq.xml
@@ -8,7 +8,6 @@
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
-cp $c1 galaxy.json &&
 seqtk seq -q $q
 -X $X
 #if $n:
@@ -36,26 +35,24 @@ $x2
 @CONDITIONAL_GZIP_OUT@
     ]]></command>
     <configfiles>
-    <configfile name="c1">
-        #set $ext = None
-        #if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
-            #set $ext = "fasta.gz"
-        #elif $A
-            #set $ext = "fasta"
-        #else
-            #set $ext = $in_file.ext
-        #end if
-        
-        {"default": {"ext": "$ext"}}
-    </configfile>
-</configfiles>
+        <configfile filename="outputs.json">
+#if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
+    #set $ext = "fasta.gz"
+#elif $A
+    #set $ext = "fasta"
+#else
+    #set $ext = $in_file.ext
+#end if
+{"default": {"ext": "$ext"}}
+        </configfile>
+    </configfiles>
     <inputs>
         <expand macro="in_faq"/>
         <param argument="-q" type="integer" value="0" label="Mask bases with quality lower than INT" />
         <param argument="-X" type="integer" value="255" label="Mask bases with quality higher than INT" />
-        <param argument="-n" type="text" value="0" label="Masked bases converted to CHAR; 0 for lowercase" />
+        <param argument="-n" type="text" value="" label="Masked bases converted to CHAR; leave empty for lowercase masking" />
         <param argument="-l" type="integer" value="0" label="Number of residues per line; 0 for 2^32-1" />
-        <param argument="-Q" type="integer" value="33" label="Quality shift: ASCII-INT gives base quality" />
+        <param argument="-Q" type="integer" value="33" label="Quality shift: ASCII-INT gives base quality" help="Only applied during comparison to quality thresholds for masking" />
         <param argument="-s" type="integer" value="11" label="Random seed" help="Effective with -f" />
         <param argument="-f" type="float" value="1" label="Sample fraction of sequences" />
         <param argument="-M" type="data" format="bed,txt" optional="true" label="Mask regions in BED or name list file" />
@@ -68,7 +65,7 @@ $x2
         <param name="x1" argument="-1" type="boolean" truevalue="-1" falsevalue="" checked="false" label="Output the 2n-1 reads only" />
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
-    <outputs>
+    <outputs provided_metadata_file="outputs.json">
         <data name="default" format="auto" label="${tool.name} on ${on_string}" />
     </outputs>