Python script for calling SNPs, MNPs, and indels in mitochondrial DNA (mtDNA). MtDNA is maternally inherited, hence "call Mom". Script takes as input a reference sequence, and a fasta file with individual mtDNA sequences. The script identifies variants with respect to the reference and outputs in VCF format.
How to use:
./callMom.VERSION.py REFERENCE INDIVIDUALS
Where:
VERSION is the downloaded version of callMom
The REFERENCE is a single fasta file, such a the rCRS (Cambridge Reference Sequence)
The INDIVIDUALS file has a series of fasta files in the format:
>sample id ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
The sequence should be the same length as the reference, and all on a single line.