STRdust is a tandem repeat genotyper for long reads, returning the repeat length and sequence in VCF format. STRdust performs realignment of reads overlapping with a repeat locus to an artificial reference sequence from which the repeat was removed. STRdust was developed while investigating the pathogenic GOLGA8A repeat expansion, and as such was not primarily intended as a general-purpose tandem repeat genotyper. This is reflected by a benchmark of repeat genotypers, where STRdust v0.16.0 performs the best of the tested tools on the detection of pathogenic alleles, but less so in the nucleotide-level precision of repeat lengths without expansion.
Preferably, for most users, download a ready-to-use binary for your system to add directory on your $PATH from the releases.
You may have to change the file permissions to execute it with chmod +x STRdust
Alternatively, you can install the tool using cargo:
git clone https://github.com/wdecoster/STRdust.git
cd STRdust
cargo build --releaseSTRdust -r chr7:154654404-154654432 reference.fa sample.cram > sample.vcf
STRdust --pathogenic reference.fa sample.cram | bgzip > sample.vcf.gz
STRdust -R targets.bed --haploid chrX,chrY reference.fa male_sample.cram | bgzip > repeats.vcf.gz
STRdust --mode fast -R genome_wide_catalog.bed reference.fa sample.cram | bgzip > repeats.vcf.gzThe 'test_data' directory contains a small example dataset to test the tool:
STRdust -r chr7:154654404-154654432 test_data/chr7.fa.gz test_data/small-test-phased.bam > small-test-phased.vcf STRdust [OPTIONS] <FASTA> <BAM>
ARGS:
<FASTA> reference genome used for alignment
<BAM> bam/cram file to call STRs in (local path or URL)
SPECIFY ONE OF:
-r, --region <REGION> region string to genotype expansion in (format: chr:start-end, 1-based inclusive)
-R, --region-file <REGION_FILE> Bed file with region(s) to genotype expansion(s) in (supports .bed and .bed.gz)
--pathogenic Genotype the pathogenic STRs from STRchive
OPTIONS:
-m, --minlen <MINLEN> minimal length of insertion/deletion operation [default: 1]
-s, --support <SUPPORT> minimal number of supporting reads per haplotype [default: 3]
--mapq <MAPQ> minimum mapping quality of a read to be used [default: 10]
-t, --threads <THREADS> Number of parallel threads to use [default: 1]
--sample <SAMPLE> Sample name to use in VCF header, if not provided, the bam file name is used
--somatic Print information on somatic variability
--unphased Reads are not phased, will cluster the reads to phase expansions
--consensus-reads Maximum number of reads to use to build the consensus sequence [default: 20]
--max-number-reads Max number of reads to extract per locus for genotyping (-1 for all reads) [default: 60]
--max-locus <MAX_LOCUS> Maximum locus size to consider; larger intervals are filtered out
--find-outliers Identify poorly supported outlier expansions (only with --unphased)
--min-haplotype-fraction <F> Minimum fraction of reads for a cluster to be a haplotype (only with --unphased) [default: 0.1]
--phasing <STRATEGY> How to split unphased reads into haplotypes: 'ward', 'dbscan' or 'both' (only with --unphased) [default: ward]
--haploid <HAPLOID> comma-separated list of haploid (sex) chromosomes
--alignment-all Always use full alignment (disable fast reference check via CIGAR)
--mode <MODE> How to recover the repeat sequence from a read: 'sensitive' or 'fast' [default: sensitive]
--fast-flank <FAST_FLANK> How far outside the interval an insertion still counts, with --mode fast [default: 20]
--sorted Sort output by chrom, start and end
--debug Debug mode
-h, --help Print help information
-V, --version Print version information
-
BED files can be provided in plain text or gzipped format (
.bedor.bed.gz) -
Lowering the number of consensus reads may lead to lesser accurate alternative allele sequences (selecting randomly from the reads), but may greatly improve speed. Note that in the case of somatic length variation, a small number of randomly selected reads may lead to a bias and not be representative of the true repeat length.
-
Genotyping known pathogenic repeats with the
--pathogenicflag will return a VCF with the pathogenic STRs from STRchive, but currently only for the GRCh38 reference. -
For unphased data (
--unphased), STRdust splits the reads into (at most) two haplotypes before building consensus. Three strategies are available via--phasing:ward(default): hierarchical (Ward) clustering on a length-weighted Levenshtein distance. The distance is dominated by how much two reads differ in length, so reads are grouped primarily by length. Robust for the common case where alleles differ mainly in length, but it tends to fragment a single length-variable expansion across several length bins.dbscan(experimental): DBSCAN on length-invariant k-mer composition feature vectors, i.e. it groups reads by their sequence composition (which motif they are made of) rather than primarily by length. This is the key difference fromward: two reads of the same motif cluster together even when their lengths differ a lot, so a length-variable expansion is kept together as one allele. The trade-off is that the reference and expanded alleles must differ in composition for DBSCAN to separate them. The two largest clusters become the haplotypes; remaining clusters and noise reads are reported asOUTLIERS, and the total number of clusters is reported inNCLUSTERS(so loci withNCLUSTERS > 2, i.e. complex/multi-population loci, can be flagged downstream). Its internal parameters (neighbourhood radius and length weight) are hardcoded — see Tuning and hardcoded parameters.both(QC mode): report thewardcall as usual, but additionally rundbscanand, when the two disagree by more than 2x on the longer allele, raise aDISCORDANT_LENGTHflag and report the DBSCAN allele lengths inDBSCAN_RB. This deliberately over-flags (it prioritises sensitivity) and is intended as a triage signal: a worklist of loci worth reviewing where the two orthogonal clustering approaches disagree. The reported genotype is unchanged fromward.
-
By default, STRdust uses a fast reference check (QUICKREF) to skip full alignment at loci that appear to be homozygous reference. It inspects the CIGAR strings of the first 25 reads spanning a locus, and if at least 5 are found and none show a length difference from the reference of more than 3 bp, the locus is called 0|0 immediately. Loci called this way are marked with a
QUICKREFflag in the VCF INFO field. This substantially speeds up runs on samples with many reference-like loci. To disable this optimisation and always perform full alignment, use--alignment-all. -
--modechooses how the repeat sequence of a read is recovered, trading sensitivity against speed.sensitive(default) builds an artificial reference with the repeat excised, re-aligns every read to it with minimap2, and takes the sequence that fails to align as the allele. It can recover an allele from a read whose original alignment clipped or misplaced the repeat, which is what large expansions look like. It is also expensive: re-aligning whole (tens of kb) reads is essentially the entire runtime.fastcuts the allele straight out of the alignment already in the BAM/CRAM, by walking the CIGAR from the repeat start to the repeat end. The slice contains the reference-matching repeat copies as well as any inserted bases, and is shortened by deletions, so it is the full repeat sequence as the read carries it - not only the inserted part. Everything downstream (haplotype splitting, consensus, VCF) is unchanged.- Aligners place a large insertion inconsistently, often tens of bases off the annotated repeat: at one locus tested the same ~900 bp insertion sits anywhere across a 30 bp stretch depending on the read. Insertions of at least 3 bases lying within
--fast-flankbases of the interval therefore count towards the allele too. Deletions need no such tolerance - a deletion has a reference span, so one that belongs to the repeat overlaps the interval and is already reflected in the slice, while one lying entirely outside belongs to a neighbouring event and must not shorten the allele. - In
fastmode a read is dropped when it does not span the locus, when its alignment clips within 100 bases of the repeat (the clipped bases may be the expansion the aligner gave up on), or when the repeat is deleted from it entirely. If that leaves a haplotype below what a call needs, the locus falls back tosensitive, which can still recover an allele from those reads. Over-dropping only costs time; under-dropping would cost a false reference call at exactly the loci that matter most. - On a 30x ONT genome,
fastgenotyped 2000 catalog loci in 7 s of CPU against 1016 s forsensitive(140x, and 284 MB against 643 MB peak memory). Per-haplotype median read lengths (MRL) are identical tosensitiveat 56% of alleles and within 2 bp at 93%. Treat that as agreement, not accuracy: neither mode has been benchmarked against a truth set yet, so where they differ it is not established which is right.
STRdust produces a VCF file per sample. The consensus sequence is in the ALT field, with sequences from each read in the SEQS INFO field (when running with --somatic). The FRB FORMAT field is the total repeat length, of the two alleles, in nucleotides. The RB field is the difference between the indidiual allele lengths and the reference length. The MRL FORMAT field is the median read length per allele (relative to the reference). Because it is a median rather than the POA consensus length, it is more robust to a long tail of length-variable reads, and comparing it to RB highlights alleles whose consensus length is being pulled by a skewed read distribution. The SC FORMAT field is a measure of accuracy of the consensus sequence compared to the overlap graph from the individual reads, which could be influenced by the presence of sequencing errors or somatic variation.
Two locus-level quality flags are raised automatically when running with --unphased (no extra options needed):
EXPANSION_OUTLIER: at least 2 reads are more than 2x longer than the longer called allele. This catches a larger expansion that was missed by both alleles because its few reads fell to noise/outliers during clustering, or were dropped as length outliers when building the consensus. The thresholds (2 reads, 2x) are currently fixed; they were chosen to suppress single-read artifacts while still surfacing genuine multi-read expansions.IMPRECISE_LENGTH: a called allele's reads have a wide length spread (coefficient of variation, std_dev/mean, above 0.2). At such loci the underlying length distribution is continuous or long-tailed, so a single consensus length is not a faithful summary — compare RB and MRL, and treat the call with caution. The 0.2 threshold is currently fixed.
Example output:
(header cropped for brevity)
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the repeat interval">
##INFO=<ID=STDEV,Number=2,Type=Integer,Description="Standard deviation of the repeat length">
##INFO=<ID=SEQS,Number=1,Type=String,Description="Sequences supporting the two alleles">
##INFO=<ID=OUTLIERS,Number=1,Type=String,Description="Outlier sequences much longer than the alleles">
##INFO=<ID=NCLUSTERS,Number=1,Type=Integer,Description="Number of read clusters found by the DBSCAN phasing strategy (>2 indicates a complex multi-population locus)">
##INFO=<ID=CLUSTERFAILURE,Number=0,Type=Flag,Description="If unphased input failed to cluster in two haplotype">
##INFO=<ID=EXPANSION_OUTLIER,Number=0,Type=Flag,Description="At least 2 reads are more than 2x longer than the longer called allele, suggesting a larger expansion missed by both alleles (only with --unphased)">
##INFO=<ID=IMPRECISE_LENGTH,Number=0,Type=Flag,Description="A called allele has a wide read-length spread (coefficient of variation > 0.2); the reported consensus length may not be representative">
##INFO=<ID=DISCORDANT_LENGTH,Number=0,Type=Flag,Description="With --phasing both: the reported Ward call and the DBSCAN call differ by more than 2x on the longer allele; see DBSCAN_RB (QC only, fires liberally)">
##INFO=<ID=DBSCAN_RB,Number=2,Type=Integer,Description="With --phasing both: DBSCAN allele lengths relative to reference, reported when DISCORDANT_LENGTH is set">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=RB,Number=2,Type=Integer,Description="Repeat length of the two alleles in bases relative to reference">
##FORMAT=<ID=FRB,Number=2,Type=Integer,Description="Full repeat length of the two alleles in bases">
##FORMAT=<ID=MRL,Number=2,Type=Integer,Description="Median read length of the two alleles' clusters in bases relative to reference, robust to a long length tail">
##FORMAT=<ID=PS,Number=1,Type=Integer,Description="Phase set identifier">
##FORMAT=<ID=SUP,Number=2,Type=Integer,Description="Read support per allele">
##FORMAT=<ID=SC,Number=2,Type=Integer,Description="Consensus score per allele">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT HG00271.hg38
chr1 1435798 . TGGCGCGGAGCGGCGCGGAGCG GCTGGCGCGGAGCGGCGCGGA,GCGGGCGCGCGCAGGA . . END=1435818;STDEV=1,2 GT:RB:FRB:MRL:SUP:SC 1|2:1,-4:21,16:1,-4:18,6:63,41
chr1 57367044 . AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAAT AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAA,AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAA . . END=57367125;STDEV=3,0 GT:RB:FRB:SUP:SC 1|2:-9,-34:72,47:17,12:216,141
A STRdust record describes one catalog interval, not a minimal variant:
POS,ENDandREFalways come from the target interval, never from the reads. The same BED entry therefore yields the same coordinates and the sameREFin every sample, which is what makes records joinable across a cohort.REFandALTcarry the whole repeat sequence, not a parsimonious left-aligned allele. This is the usual convention among tandem repeat callers, but it meansbcftools normwill realign most records and move their positions, breaking any join back to the catalog. Compare STRdust output against a truth set on the unnormalised records, or normalise both sides.ALTmay describe bases lying just outside[POS, END]. Both modes deliberately count indels the aligner placed near, but not inside, the annotated interval, because repeat boundaries in a catalog rarely agree with where an aligner puts an indel (see--modeabove). The allele length is right, but the record is not a strict "replaceREFat these coordinates withALT" statement, so reconstructing a haplotype from it (bcftools consensus) can place those bases up to a few tens of bases off. Read the lengths fromRB,FRBandMRLrather than reconstructing fromALT.GTuses|only when the input reads were phased by an external tool, which is also whenPSis reported. Alleles obtained by clustering unphased reads are written1/2: they are two alleles of one genotype, with no phase relationship to anything else. One consequence is that a phased run mixes separators - loci called through the QUICKREF path never fetch reads, so they carry no phase set and are written0/0. Those loci are homozygous reference, where phase carries no information either way.
STRdust was developed while investigating the pathogenic GOLGA8A repeat expansion, and a benchmark of repeat genotypers found it to be the most sensitive of the tested tools for detecting actual pathogenic expansions. Maximising that sensitivity is a priority, and several of the heuristics that support it are intentionally kept as hardcoded constants rather than command-line arguments. A parameter is only worth exposing if a user can tell how to tune it, and exposing all of these would inflate the option list without helping most users. Each is defined as a documented constant in the source so it can be changed (and promoted to a CLI argument) if real cohort experience shows a need:
| Parameter | Value | Where (source) | Tuning intuition |
|---|---|---|---|
EXPANSION_OUTLIER min reads / ratio |
≥ 2 reads, > 2x longer allele | src/genotype.rs |
lower either for more sensitivity to few-read / single-read expansions, at the cost of more artifact flags |
IMPRECISE_LENGTH length CV |
> 0.2 | src/consensus.rs |
lower flags more loci as length-imprecise; raise to flag only the most spread-out |
DISCORDANT_LENGTH ratio (--phasing both) |
> 2x longer allele | src/genotype.rs |
lower to surface smaller Ward/DBSCAN disagreements for QC review |
DBSCAN neighbourhood radius (eps) |
0.4 | src/phase_insertions.rs |
smaller = tighter/more clusters (more splitting, more reads dropped to noise → can undercall length-variable expansions); larger = looser clusters that can merge distinct alleles. Adjust in ±0.1 steps and watch NCLUSTERS |
| DBSCAN length weight | 0.3 | src/phase_insertions.rs |
lower = composition dominates (keeps length-variable expansions together); higher = length matters more (separates same-motif alleles that differ only in length, behaving more like ward) |
FLANK_MIN_INDEL (--mode fast) |
3 bases | src/parse_bam.rs |
smallest insertion in the flank that counts towards the allele. Lower it and single-base alignment noise beside the locus starts moving allele lengths; raise it and small repeat-boundary indels are missed. Weakly determined — anything from 3 to 10 performed within noise on the sample tested |
CLIP_SEARCH (--mode fast) |
100 bases | src/parse_bam.rs |
how close a clipped alignment end has to be before the read is considered untrustworthy and dropped. Raising it drops more reads and sends more loci to sensitive, which is the safe direction; lowering it risks reporting a reference-length allele for a read that clipped through an expansion |
If you have a specifically challenging repeat expansion where the defaults do not work well, we would be happy to work with you — please open an issue with details.
Contributor setup, the development workflow, testing (including the
network-dependent TEST_PATHOGENIC_NETWORK / TEST_PATHOGENIC_FULL tests), code
quality standards, and CI are documented in CONTRIBUTING.md.
If you use this tool, please consider citing our publication.