Ensure correct output formats of seqtk_seq and seqtk_mergefa in all cases

tools/seqtk/seqtk_seq.xml

@@ -1,5 +1,5 @@
 <?xml version="1.0"?>
-<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
+<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@+galaxy1" profile="22.05">
     <description>common transformation of FASTA/Q</description>
     <macros>
         <import>macros.xml</import>
@@ -54,25 +54,36 @@ $x2
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}" />
+        <data name="default" auto_format="true" label="${tool.name} on ${on_string}" />
     </outputs>
+
     <tests>
         <!-- This is a sorry excuse for a test for a tool which does way more
              than it should, but upstream decided to put a TON of functionality
              into a single tool rather than using the single responsibility
              principle. -->
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa" ftype="fasta"/>
         </test>
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa.gz" ftype="fasta.gz"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta.gz"/>
         </test>
+        <test expect_num_outputs="1">
+            <param name="in_file" value="seqtk_trimfq.fq" ftype="fastq"/>
+            <param name="A" value="True" />
+            <output name="default" file="seqtk_seq_A.fasta" ftype="fasta"/>
+        </test>
+        <test expect_num_outputs="1">
+            <param name="in_file" value="seqtk_trimfq.fq.gz" ftype="fastq.gz"/>
+            <param name="A" value="True" />
+            <output name="default" file="seqtk_seq_A.fasta.gz" ftype="fasta.gz"/>
+        </test>
     </tests>
     <help><![CDATA[
 **What it does**

tools/seqtk/test-data/seqtk_seq_A.fasta

@@ -0,0 +1,2 @@
+>SEQ_ID1
+GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT